breakfast of champions

Joined

• started 139 topics
• posted 5,192 times   see topics posted on
• send a message

Posts by breakfast of champions

• 
  126

  FEB 2016 broadcast

  by Grey Goose in

  1. jw
  2. friends

  it might be the craziest one yet..

  1. 
  2. 
  3. 
• 

  breakfast of champions

  That clip was just about one of the most bizarre things I have ever watched in my life.

  A jump-the-shark moment.
• 
  38

  2016-1-25-BOE on Applause or Clapping!

  by Atlantis in

  1. watchtower
  2. bible

  just in case someone wanted this letter for their records.

  .. http://postimg.org/image/dn44a9m9h/.

  .. petra!.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  An interesting story from our local cong:

  So within the past year, a young brother who everyone always loved (really nice kid) was reinstated and the congregation spontaneously exploded into applause. So, the COBE then runs up to the stage immediately after this happens and rather brusquely announces, "we'd like to inform the congregation that there is not to be clapping during a reinstatement announcement. Thank you."

  This did not go over well in the hall, as the congregation here is actually quite warm and loving (in their weird JW way) and most thought this was a bullshit move. In fact, there were even folks complaining about the COBE incident on Facebook.

  Evidently, the kerfluffle over this got so big, there was a "local needs" in which another elder tries to do damage control, half-apologizing for the rather uncaring way this was handled by the COBE, yet going over the information from the society as to why the practice of clapping after a reinstatement is forbidden (it's all scripurally-based, of course )

  Then a few weeks later, another young guy was reinstated, and the response is --- crickets.

  I would just LOVE to know what is going on in the minds of both these elders when they get this letter. In the end, they were just doing what they were told, company men, and now they have to eat their words. . . .
• 
  17

  Science Alert Quiz

  by cofty in

  1. watchtower
  2. beliefs

  take the test fellow hominids.... i got 7/7.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  Woohoo!

  7 of 7
• 
  17

  Gems From the WT

  by Slidin Fast in

  1. watchtower
  2. beliefs

  just noticed this gem of a definition in the current (no 1) wt.

  "lying.

  saying something false to someone who is entitled to know the truth.".

  1. 
  2. 
  3. 
• 

  breakfast of champions

  Actually, they're wrong at the "saying something false" part. Lying is saying something you know to be false.

  For instance, someone might ask "Where's Mrs BoC?" and knowing that Mrs. BoC said she was going to the food store, I would say "She's at the food store." However, Mrs. BoC might have decided not to go the food store, and to go to the library instead.

  So although I was stating something false (Mrs BoC went to the food store, when she's actually at the library) I would not be lying.

  I'd be wrong, but not lying.
• 
  27

  You Are Unsuitable!

  by Divergent in

  1. jw
  2. friends

  today's text -.

  sunday, january 24. they collected the fine ones into containers, but the unsuitable they threw away.—matt.

  13:48.. understanding the lesson of this illustration helps us to avoid being overly distraught or disappointed if a bible student or one of our children does not make the truth his own.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  I've considered myself "unsuitable" ever since I tossed my meeting suit into the Goodwill bin.
• 
  12

  Evolution is a Fact #9 - Less Chewing More Thinking

  by cofty in

  1. watchtower
  2. beliefs

  if you put your fingers on the side of your head, just above your ears, and move your jaw you will be able to feel your temporalis muscles doing their thing.. compared to our primate cousins our temporalis muscles are puny - approximately one eighth the size.

  the reason for the difference is a mutation of the myh16 gene in humans that produces a protein called myosin heavy chain 16. in primates like the gorilla this protein produces the powerful chewing pressure of the jaw.. our closest hominid relative, the chimpanzee have an intact myh16 gene.

  since the rate of mutation can be determined, hansell stedman and his team at the university of pennsylvania have calculated that the mutation that disabled the gene in our line happened between 2.1 and 2.7 million years ago.. the large temporalis muscle has to anchor to very thick and strong skull bones.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  Super interesting stuff again COFTY.

  What really fascinates me is how they determine how many years (generations) ago a given mutation occurred. Would love to learn more about that process . . .
• 
  44

  Honeymoon over for the carts

  by Deltawave in

  1. watchtower
  2. beliefs

  speaking with inlaws i another congregation today who said exactly what is being said in our own hall.

  the trolly work is long and boring and no one even notices they are there anymore but walk right on by.

  jehovah really is speeding up the work lol.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  They're going to have to build some kind of hot coffee dispenser off the back of those things.
• 
  52

  The Deep Things of Jehovah(tm). What are they?

  by punkofnice in

  1. watchtower
  2. bible

  i just wondered.

  .

  1. 
  2. 
  3. 
• 

  breakfast of champions

  I agree with everything above.

  Personally, I think it's part of the whole thought reform/brainwashing technique.

  Telling someone that they can't understand something (in this case, pure bullshit) because it's too "deep" for them to understand is really just a subtle way to disparage or attack a person's built-in critical thinking machinery. You don't understand this? Well, there must be something deficient with YOU. No possiblility that this is just total crap and that's why it's incomprehensible.

  It's actually a liberating feeling when you realize that, if you put in the time and effort, you CAN actually understand some truly deep ideas (physics, biology, philosophy, whatever interests you.) Yeah, maybe you'll never know everything, but you can sure as hell rule out garbage like the stuff WT spews out there.
• 
  13

  Snow fall in Jan 2015

  by Lostandfound in

  1. jw
  2. friends

  will the expected heavy snow isolate warwick ny, or brooklyn.

  i hope the snow traps the gb showing clearly jehovah's favour and blessing.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  Doesn't look like it. Looks like the worst will be further south, Philly and that area.

  So much for my career in meteorology. . . .

  It's already up to my knees out there and there's no sign of it slowing down.
• 
  3

  Evolution is a Fact #8 - Jumping Genes

  by cofty in

  1. watchtower
  2. beliefs

  we have all become familiar with the use of dna in forensics and paternity disputes.

  all humans share 99.9% of their genome in common, but that still leaves plenty room for variation.. geneticists are able to study sections of dna that identify an individual and their closest relatives.

  mostly these genetic markers are found in our non-coding dna such as the sections of code known as transposons.. one type of transposon is known as the alu element.

  1. 
  2. 
  3. 
• 

  breakfast of champions

  So .. . . . thanks to COFTY'S "Fact #8" post, we have all learned that Jehovah threw some ALU's in our DNA to PROVE that he knew how to cut-and-paste before any of us poor bastards did.

  What COFTY failed to point out is that Jehovah also used "emojis" well before humans did. Consider the gene that codes for STUPID_BLANK_STARE:

  ATTTAGCCCGGATTTAGCCCGGATA : | ATTAGCCGATCGATGATCGAC

  The evidence for God is literally staring you in the face.